Frequency and specificity of alloantibodies to HNA system antigens in donors of blood and blood components

Cover Page

Abstract


Aim. To study the rate of human neutrophil antigens (HNA) alloimmunization in donors of blood and blood components.

Methods. The study included blood samples of 1,127 donors who donated blood and its components in the Russian Scientific and Research Institute of Hematology and Transfusiology, Saint Petersburg, 635 male and 492 female. 36.18% of female donors were aged between 18 and 30 (n=178) and 63.82% were aged between 30 and 60 (n=314). The medical histories of all donors did not contain the records about the transfusion of blood components. Screening and identification of HNA alloantibodies were performed using the flow cytometric granulocyte immunofluorescence test with monoclonal antibodies CD16-PE, CD45-PC7, CD19-APC, Goat F(ab')2 Anti-Human IgG-FITC and the panel of donor neutrophils with detected HNA genotypes.

Results. The frequency of HNA alloantibodies in blood donors was 0.35% (n=4). No HNA alloantibodies were found in the male donors. Alloantibodies were detected only in female blood donors aged between 30 and 60. HNA antibody frequency in female donors was 0.81%. It were detected anti-HNA-1a, anti-HNA-3b and anti-HNA-4b antibodies of the IgG immunoglobulin class. In one donor, the specificity of antibodies could not be established. To establish whether detected antibodies in immunized donors were alloantibodies, HNA genotypes were determined.

Сonclusion. HNA alloantibodies occur with low frequency and are determined in 0.35% of blood donors. Alloantibodies were detected only in female donors and were directed against HNA-1a, HNA-3b and HNA-4b. The frequency of HNA antibodies in female donors was 0.81%. HNA genotyping confirmed that detected antibodies were alloantibodies.


Full Text

Аллоантитела к антигенам систем Human Neutrophil Antigens (HNA) играют ключевую роль в возникновении ряда реакций и осложнений, связанных с трансфузией плазмосодержащих компонентов донорской крови у пациентов с гемобластозами и депрессиями кроветворения, а также с другими заболеваниями. Тяжесть возникших посттрансфузионных реакций и осложнений варьирует от гипертермической (фебрильной) негемолитической реакции до острого трансфузионно-обусловленного повреждения лёгких (ОТОПЛ), нередко приводящего к летальному исходу. Этому способствуют особенности течения заболевания, особенно сочетание с иммунодефицитными состояниями реципиента, необходимость использования высокодозной химиотерапии, трансплантация костного мозга и др.

Многочисленные работы исследователей показали, что частота антител к HNA в донорской плазме, причастной к ОТОПЛ, варьировала в пределах 3–33%. Выявленные антитела имели специфичность анти-HNA1, анти-HNA2 и анти-HNA3а. C наиболее тяжёлыми и даже смертельными реакциями ОТОПЛ ассоциированы анти-HNA-3а антитела. Большинство донорских компонентов крови, причастных к ОТОПЛ, было заготовлено от доноров-женщин, имевших беременности и/или трансфузии в анамнезе [1–3].

Стандартными методами выявления анти-­HNA антител служат тесты агглютинации и иммунофлюоресценции гранулоцитов. Исследования стандартными методами требуют серьёзных затрат времени и технически сложны. Для их осуществления необходимо выделение свежих гранулоцитов, что нередко сопровождается большой потерей клеток. Внедрение современных методов исследования иммунного ответа расширяет возможности лабораторной диагностики иммунных состояний. Метод проточной цитофлуориметрии, представляющий собой модификацию теста иммунофлюоресценции гранулоцитов, позволяет проводить исследование различных популяций лейкоцитов без предварительного разделения клеток в градиенте плотности фикола и без применения микроскопа [4].

Существует ограниченное количество проспективных скрининговых исследований по выявлению анти-HNA аллоантител [5, 6]. Сведения о частоте аллоантител к HNA у доноров крови и её компонентов в Российской Федерации отсутствуют. B связи с этим представляется актуальным оценить уровень HNA-аллоиммунизации доноров крови и её компонентов, что будет способствовать поиску новых путей профилактики реакций и осложнений, связанных с трансфузией компонентов крови.

Цель работы — исследовать уровень аллоиммунизации к антигенам системы HNA у доноров крови и её компонентов.

Протокол исследования одобрен локальным этическим комитетом Федерального государственного бюджетного учреждения «Российский научно-исследовательский институт гематологии и трансфузиологии Федерального медико-биологического агентства» (ФГБУ ­РосНИИГТ ФМБА, протокол №49 от 18.12.2019).

В исследование были включены образцы крови 1127 доноров, дающих кровь и её компоненты в ФГБУ РосНИИГТ ФМБА России: 635 мужчин и 492 женщин. Доноров-женщин в возрасте 18–30 лет было 36,18% (n=178), в возрасте 30–60 лет — 63,82% (n=314). Все обследованные доноры не имели в анамнезе трансфузий компонентов крови.

Объектом исследования служили образцы лейкоцитов, которые были выделены из цельной крови, стабилизированной К2-EDTA, и сыворотки крови доноров, полученные путём пункции периферической вены и собранные в вакуумные пробирки без антикоагулянта. Лейкоциты были получены путём лизиса эритроцитов (лизирующий раствор VersaLyse, Beckman Coulter Inc., USA) и трёхкратного отмывания в фосфатно-солевом буфере. Процедуру лизиса осуществляли согласно инструкции производителя. Все исследования проводили в день взятия крови.

Скрининг аллоантител к антигенам HNA-1a/1bc/bd, HNA-2a, HNA-3a/3b, HNA-4a/4b HNA-5a/5b осуществляли в непрямом тесте иммунофлюоресценции гранулоцитов методом проточной цитофлуориметрии с использованием моноклональных антител CD16-PE, CD45-PC7, CD19-APC, Goat F(ab')2 Anti-Human IgG-FITС (все антитела производства Beckman Coulter Inc., США) и панели донорских нейтрофилов с установленным HNA-генотипом.

Выявление антител проводили в три этапа.

Первый этап — скрининг антител. Для скрининга использовали две клеточные линии, в которых были представлены все антигены HNA.

Все стадии подготовки образцов к цитометрическому анализу осуществляли в полипропиленовых пробирках для цитометрии 12×75 мм (Beckman Coultеr, США).

4×105 донорских лейкоцитов инкубировали с 30 мкл исследуемой сыворотки в течение 15 мин при 37 °C. Затем клетки отмывали трижды фосфатно-солевым буфером. В пробирки с отмытыми клетками добавляли по 20 мкл моноклональных антител CD16-PE, CD45-PC7, CD19-APC и 20 мкл раствора Goat F(ab')2 Anti-Human IgG-FITС [10 мкл Goat F(ab')2 Anti-Human IgG-FITС ресуспендировали в 100 мкл фосфатно-солевого буфера]. Пробирки инкубировали в тёмном месте 20 мин. Лейкоциты отмывали в фосфатно-солевом буфере (1:10). Полученный образец ресуспендировали в 500 мкл фосфатно-солевого буфера. Анализ проводили в проточном цитофлуориметре. Настройку проточного цитофлуориметра осуществляли в соответствии с рекомендациями, изложенными С.В. Хайдуковым и соавт. [7], а также в соответствии с рекомендациями производителя антител.

Для определения областей позитивного и негативного связывания анти-IgG антител применяли образцы, окрашенные только вторыми антителами (без предварительной обработки сыворотками, потенциально содержавшими аутореактивные антитела). Данные области (как это показано на рис. 1) выставляли для нейтрофилов (левые гистограммы), моноцитов (центральная гистограмма) и общей популяции Т-лимфоцитов и натуральных киллеров (правые гистограммы) периферической крови. Результат считали отрицательным, если клетки находились в первой декаде, а их доля составляла менее 15%. Результат считали положительным, если клетки находились во второй декаде, а их доля составляла 15% и более. В положительных образцах проводили идентификацию антител. Оценка связывания антител с моноцитами и лимфоцитами позволяла проводить дифференциацию между антителами к нейтрофилам и к другим популяциям лейкоцитов (см. рис. 1).

 

Рис. 1. Примеры цитофлуориметрического анализа негативного (отсутствие связывания анти-IgG аллоантител, верхний ряд гистограмм) и позитивного (выраженное связывание анти-IgG аллоантител, нижний ряд гистограмм) образцов

 

Слева направо на гистограммах приведены результаты взаимодействия анти-IgG аллоантител с нейтрофилами, моноцитами, а также общей популяцией лимфоцитов, состоящей из Т-лимфоцитов и натуральных киллеров, периферической крови. Результат приведён в виде % позитивных клеток в каждой из проанализированных популяций. Область позитивного связывания («IgG+» на соответствующих гистограммах) выставлена на основании образцов, окрашенных только вторыми анти-IgG антителами (фоновое связывание вторых ­антител).

В качестве отрицательного контроля использовали лейкоциты донора, инкубированные с аутосывороткой и контрольной сывороткой группы крови АВ. В качестве положительного контроля использовали лейкоциты донора, инкубированные с поливалентной контрольной сывороткой, содержащей анти-HNA/HLA аллоантитела [набор сывороток антилейкоцитарных HLA-A, -B, -C, -DR гистотипирующих жидких (HLA) «HLA-сыворотки», ЗАО МЦИиГР «Гисанс», Санкт-Петербург].

Второй этап — идентификация антител. Для идентификации были использованы панели донорских нейтрофилов со следующими генотипами:

– HNA-1a/a, HNA-2a, HNA-3a/a, HNA-4a/a, HNA-5a/a;

– HNA-1bd/bd, HNA-3a/b, HNA-4b/b, ­HNA-5a/b;

– HNA-1a/bd/bc, HNA-2a, HNA-3a/b, HNA-4a/b, HNA-5a/b;

– HNA-1a/a, HNA-2a, HNA-3b/b, HNA-4a/b, HNA-5b/b.

Третий этап. Для подтверждения полученных результатов установили генотип HNA в образцах крови, в которых были идентифицированы антитела.

Генотипирование HNA проводили методом аллель-специфичной полимеразной цепной реакции с использованием оригинальных олигонуклеотидных праймеров (табл. 1), как описано ранее [8].

 

Таблица 1. Последовательность олигонуклеотидных праймеров для типирования HNA-1, -3, -4, -5

Антиген

Antigen

Ген

Gene

Прямой праймер (5’–3’)

Forward primer (5’–3’)

Обратный праймер (5’–3’)

Reverse primer (5’–3’)

HNA-1а

FCGR3B

CCTCAATGGTACAGGGTGCTC

GCCTGGCTTGAGATGAGGTT

HNA-1b/с

FCGR3B

CCTCAATGGTACAGCGTGCTT

CACTGTCGTTGACTGTGGCAT

HNA-1b/d

FCGR3B

CCTCAATGGTACAGCGTGCTT

ACTGTCGTTGACTGTGGCAG

HNA-3а

SLC44A2

CTACCTCACGTACCTGAATGCT

GCAGGGCAGTCACCATCTC

HNA-3b

SLC44A2

CTACCTCACGTACCTGAATGCT

GCAGGGCAGTCACCATCTT

HNA-4а

ITGAM

CTCATGCGAGCCCATCCG

ACAAGGAGGTCTGACGGTGA

HNA-4b

ITGAM

CTCATGCGAGCCCATCCA

ACAAGGAGGTCTGACGGTGA

HNA-5а

ITGAL

ATCATCCCCCACAGATCCAG

AGCTGGACCCAGTAAGCATC

Примечание: нуклеотиды, комплементарные SNP, определяющим наличие антигена, выделены жирным шрифтом.

 

Частота аллоантител к антигенам систем HNA у обследованных доноров крови и её компонентов составила 0,35% (n=4). В группе доноров-мужчин аллоантитела к HNA выявлены не были. Все сенсибилизированные доноры были женщинами в возрасте 30–60 лет. Частота антител к HNA у доноров-женщин составила 0,81%. Выявленные антитела имели специфичность анти-HNA-1а, анти-HNA-3b и анти-HNA-4b и принадлежали к иммуноглобулинам класса G. У одного из иммунизированных доноров специфичность антител установить не удалось.

Для установления природы антител у иммунизированных доноров определяли генотипы HNA. У доноров со специфичностью антител анти-HNA-1a, анти-HNA-3b, анти-HNA-4b были определены генотипы HNA-1bd/bd, HNA-2a, HNA-3a/b, HNA-4b/b, HNA-5a/b; HNA-1bd/bd, HNA-2a, HNA-3a/a, HNA-4a/b, HNA-5a/a; HNA-1a/bd, HNA-2a, HNA-3a/a, HNA-4a/a, HNA-5a/b соответственно. У донора с неустановленной специфичностью генотип определялся как HNA-1a/bd, HNA-2a, HNA-3a/a, HNA-4a/b, HNA-5a/a. Проведённое исследование позволило установить аллогенную природу антител.

Полученные результаты по частоте аллоантител к HNA согласуются с результатами других исследователей, в частности установленная L. Jerome и соавт. частота антител к HNA у доноров составила 0,7% [5]. В нашем исследовании анти-HNA антитела выявлены только у женщин, что может быть связано с предшествующими беременностями. У мужчин антитела обнаружены не были, что связано с отсутствием трансфузий в анамнезе. Аналогичные данные были получены А. Real и соавт. при обследовании 5332 женщин-доноров с тремя и более беременностями в анамнезе. Причём у большинства женщин, аллоиммунизированных к HNA, также присутствовали анти-HLA аллоантитела, в то время как у мужчин аллоантитела выявлены не были [2].

Известно, что вероятность синтеза аллоантител у человека зависит от ряда факторов, включая генетическую предрасположенность к развитию сенсибилизации, особенностей фенотипа HNA, количества трансфузий и беременностей в анамнезе. Для развития аллоиммунизации также важна частота антигена в популяции. Так, если частота HNA-1a равна 62–65%, то риск развития аллоиммунизации составит 23,3%, что обусловливает высокую вероятность несовместимости донор-реципиент при трансфузии и может привести к выработке антител [8]. Если частота антигена мала или очень высока, вероятность иммунологического конфликта донор-реципиент, мать-плод будет низкой. Так, при частоте HNA-3a 96,6% риск развития аллоиммунизации составляет 3,7% [8].

Выявленные в нашем исследовании анти-HNA-1а аллоантитела могут стать причиной аллоиммунных конфликтов [2, 9, 10]. Согласно данным литературы, антитела к HNA-1, HNA-2, HNA-3а ассоциированы с тяжёлыми случаями ОТОПЛ. Так, анализ 96 случаев ОТОПЛ, проведённый С. Chapman и соавт., показал наличие анти-HNA аллоантител в 13 образцах донорской плазмы, причастной к развитию ОТОПЛ, 5 из которых имели специфичность анти-HNA-1а, 1 — анти-HNA-3а [3]. Анти-HNA-3a антитела в нашем исследовании выявлены не были, что может быть обусловлено относительно небольшой выборкой доноров. Выявленные в нашем исследовании анти-HNA-3b и анти-HNA-4b аллоантитела ассоциированы с аллоиммунной нейтропенией новорождённых [9, 10]. В литературе не встречается данных о связи этих аллоантител с ОТОПЛ. Более того, В. Bayat и соавт. показали, что антитела анти-HNA-3b не вызывали ОТОПЛ на мышиной модели [11].

Необходимость использования свежих, типированных по HNA нейтрофилов ограничивает возможность проведения скрининга анти-HNA аллоантител в клинических лабораториях медицинских организаций. В то же время значительное снижение риска развития аллоиммунизации к HLA и HNA после трансфузий достигается путём внедрения в практику методов лейкоредукции компонентов крови. Обязательное тестирование доноров-женщин с тремя и более беременностями в анамнезе на наличие анти-HLA антител также снизит риск возникновения посттрансфузионных реакций, связанных с анти-HNA аллоантителами.

Выводы

1. Аллоантитела к антигенам систем HNA встречаются редко и определяются у 0,35% доноров крови и её компонентов.

2. Аллоантитела к HNA выявлены только у доноров-женщин с частотой 0,81%.

3. Аллоантитела к HNA-3a, связанные с тяжёлыми и фатальными случаями острого трансфузионно-обусловленного повреждения лёгких, в исследовании не обнаружены.

4. Выявленные аллоантитела были направлены против HNA-1а, HNA-3b и HNA-4b. Аллогенная природа антител против HNA подтверждена методом генотипирования.

 

Участие авторов. И.И.К. — разработка методики, проведение исследования, сбор и анализ результатов; И.О.Б. — проведение исследования, сбор и анализ результатов; И.В.К. — разработка методики; Н.В.М. и А.В.Ч. — руководители работы.

Источник финансирования. Субсидия из федерального бюджета на финансовое обеспечение выполнения государственного задания.

Конфликт интересов. Авторы заявляют об отсутствии конфликта интересов по представленной статье.

About the authors

I I Krobinets

Russian Scientific and Research Institute of Hematology and Transfusiology

Author for correspondence.
Email: transfusion_spb@mail.ru
SPIN-code: 9275-1440

Russian Federation, Saint Petersburg, Russia

N V Mineeva

Russian Scientific and Research Institute of Hematology and Transfusiology

Email: transfusion_spb@mail.ru
ORCID iD: 0000-0001-7137-8877
SPIN-code: 7528-9460

Russian Federation, Saint Petersburg, Russia

I O Bogdanova

Russian Scientific and Research Institute of Hematology and Transfusiology

Email: transfusion_spb@mail.ru

Russian Federation, Saint Petersburg, Russia

I V Kudryavtsev

Institute of Experimental Medicine

Email: transfusion_spb@mail.ru
SPIN-code: 4903-7636
Scopus Author ID: 56954696800
ResearcherId: D-2124-2013

Russian Federation, Saint Petersburg, Russia

A V Chechetkin

Russian Scientific and Research Institute of Hematology and Transfusiology

Email: transfusion_spb@mail.ru
SPIN-code: 6576-8487

Russian Federation, Saint Petersburg, Russia

References

  1. Davoren A., Curtis B.R., Shulman I.A. et al. ­TRALI due to granulocyte-agglutinating human neutrophil antigen-3a (5b) alloantibodies in donor plasma: a report of 2 fatalities. Transfusion. 2003; 43: 641–645. doi: 10.1046/j.1537-2995.2003.00374.x.
  2. Reil A., Keller-Stanislawski B., Bux J. et al. Specificities of leucocyte alloantibodies in transfusion-­related acute lung injury and results of leucocyte antibody screening of blood donors. Vox Sang. 2008; 95: 313–317. doi: 10.1111/j.1423-0410.2008.01092.x.
  3. Chapman C., Stainsby D., Jones H. et al. Ten years of hemovigilance reports of transfusion-related acute lung injury in the United Kingdom and the impact of preferential use of male donor plasma. Transfusion. 2009; 49: 440–452. doi: 10.1111/j.1537-2995.2008.01948.x.
  4. Heinzl M.W., Schonbacher M., Dauber E.-M. et al. Detection of granulocyte-reactive antibodies: a comparison of different methods. Vox Sang. 2015; 108: 287–293. doi: 10.1111/vox.12227.
  5. Gottschall J.L., Triulzi D.J., Curtis B. et al. The frequency and specificity of human neutrophil antigen antibodies in a blood donor population. Transfusion. 2011; 51: 820–827. doi: 10.1111/j.1537-2995.2010.02913.x.
  6. Xia W., Xu X., Chen D. et al. The prevalence of leucocyte alloantibodies in blood donors from South China. Transfusion Med. 2015; 25: 385–392. doi: 10.1111/tme.12276.
  7. Khaydukov S.V., Baidun L.A., Zurochka A.V., Totolyan A.A. Standardized technology “study of the subpopulation composition of peripheral blood lymphocytes using flow cytofluorimeters-analyzers” (project). Medicinskaya immunologiya. 2012; 14 (3): 255–268. (In Russ.)
  8. Krobinets I.I., Mineeva N.V., Bogdanova I.O. et al. The value of the human neutrophil antigens typing of blood donors for the activity of the blood service. Transfusiologiya. 2018; (4): 23–31. (In Russ.)
  9. Mraz G.A., Crighton G.L., Christie D.J. Antibodies to human neutrophil antigen HNA-4b implicated in a case of neonatal alloimmune neutropenia. Transfusion. 2016; 56: 1161–1165. doi: 10.1111/trf.13463.
  10. Marın L., Torıo A., Muro M. et al. Alloimmune neonatal neutropenia and thrombocytopenia associa­ted with maternal anti HNA-1a, HPA-3b and HLA antibo­dies. Pediatr. Allergy Immunol. 2005; 16: 279–282. doi: 10.1111/j.1399-3038.2005.00245.x.
  11. Bayat B., Tjahjono Y., Berghofer H. et al. Choline transporter-like protein-2: New von Willebrand factor-binding partner involved in antibody-mediated neutrophil activation and transfusion-related acute lung injury. Arterioscler. Thromb. Vasc. Biol. 2015; 35 (7): 1616–1622. doi: 10.1161/ATVBAHA.115.305259.

Supplementary files

Supplementary Files Action
1.
Рис. 1. Примеры цитофлуориметрического анализа негативного (отсутствие связывания анти-IgG аллоантител, верхний ряд гистограмм) и позитивного (выраженное связывание анти-IgG аллоантител, нижний ряд гистограмм) образцов

View (47KB) Indexing metadata

Statistics

Views

Abstract - 95

PDF (Russian) - 23

Cited-By


PlumX


© 2020 Krobinets I.I., Mineeva N.V., Bogdanova I.O., Kudryavtsev I.V., Chechetkin A.V.

Creative Commons License

This work is licensed
under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License.





This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies